Adaptive Evolution of Relish, a Drosophila NF-kB/IkB Protein

NF-kB and IkB proteins have central roles in regulation of inflammation and innate immunity in mammals. Homologues of these proteins also play an important role in regulation of the Drosophila immune response. Here we present a molecular population genetic analysis of Relish, a Drosophila NFkB/IkB protein, in Drosophila simulans and D. melanogaster. We find strong evidence for adaptive protein evolution in D. simulans, but not in D. melanogaster. The adaptive evolution appears to be restricted to the IkB domain. A possible explanation for these results is that Relish is a site of evolutionary conflict between flies and their microbial pathogens. Apossible consequence of host-pathogen interacof the nuclear localization signal and subsequent translocation of NF-kB to the nucleus, where it transcriptiontions is an “arms race” resulting in rapid evolution; pathogens evolve to evade host defenses while host deally upregulates several genes. Thus, IkB proteins usually function as inhibitors of NF-kB activity. Rel proteins fenses evolve to circumvent such evasion (Levin and Lenski 1983). Proteins having a role in such an arms are found complexed with their IkB inhibitors in the cytoplasm of uninfected animals, thereby allowing initiarace might be expected to evolve quickly under the influence of natural selection. Insect cecropins are small tion of signal-induced immune response in the absence of additional production of Rel proteins. Such a mechaantibacterial proteins that insert into bacterial cell walls, causing leakage and cell death (Kylsten et al. 1990; nism allows rapid induction of the immune response. Drosophila Relish is an unusual member of the Rel Durell et al. 1992). Therefore, one plausible arena for an arms race is the interaction between Drosophila family of proteins (Dushay et al. 1996), as it possesses both Rel/NF-kB domains and an inhibitory IkB domain cecropins and Drosophila pathogens. However, molecular evolutionary analysis of cecropins in Drosophila mela(Figure 1). The mammalian p100 and p105 genes have a similar structure; however, in most cases these domains nogaster and its close relatives provided no evidence for adaptive protein evolution between species (Clark and are found in different genes (Ghosh et al. 1998). Though IkB and NF-kB proteins are known to interact, Wang 1997; Date et al. 1998; Ramos-Onsins and Aguadé 1998). Therefore, proteins in Drosophila that might there is no experimental evidence bearing on the question of whether the two functional domains of Relish be evolving as a direct or indirect result of selection pressures from microbial pathogens remain unknown. participate in direct interactions with one another. Relish is transcriptionally upregulated in response to microRel/NF-kB proteins and IkB proteins play an important role in vertebrate innate immunity and inflammabial infection (Dushay et al. 1996). Experiments done in Drosophila cell culture suggest that Relish transcription, and in regulation of the Drosophila immune response (Hoffmann and Reichhart 1997; Dushay and tionally upregulates the antibacterial gene, cecropinA1 (Dushay et al. 1996; it is not known if Relish can tranEldon 1998; Ghosh et al. 1998). Rel/NF-kB domains function in dimerization and DNA binding. IkB doscriptionally upregulate other antibacterial or antifungal genes). The IkB domain of Relish is hypothesized mains are composed primarily of ankyrin repeats, which function in protein-protein interactions. These domains to belong to the g subfamily of IkB proteins (Dushay et al. 1996), the specific functional properties of which interact to control the subcellular localization of NF-kB (Ghosh et al. 1998). IkB proteins form a complex with are poorly known (Inoue et al. 1992; Ghosh et al. 1998). We report here the results of our molecular population NF-kB proteins, maintaining the latter in an inactive cytoplasmic form, probably through interaction with a genetic analysis of Relish in D. simulans, D. melanogaster, and D. yakuba. nuclear localization signal (Baeuerle 1998; Ghosh et al. 1998; Huxford et al. 1998; Jacobs and Harrison 1998). Signal-dependent degradation of IkB results in unmasking MATERIAL AND METHODS D. melanogaster alleles (n 5 6) were sampled at random from homozygous chromosome III stocks made from isofemale Corresponding author: David Begun, Section of Integrative Biology, lines from Zimbabwe. D. simulans alleles (n 5 7) were sampled Patterson Labs C0930, University of Texas, Austin, TX 78712. E-mail: [email protected] from a set of highly inbred lines made from individual females Genetics 154: 1231–1238 (March 2000) 1232 D. J. Begun and P. Whitley Figure 1.—Region I is nucleotides 1–253; region II is nucleotides 254–1449; region III is nucleotides 1450–1905; region IV is nucleotides 1906–2756. All coordinates refer to our GenBank entries. The NF-kB domains include bases 254–1449; the ankyrin repeats include bases 1906–2556. These regions correspond to bases 807–1700 (NFkB) and 2151–2801 (ankyrin repeats) of the original D. melanogaster GenBank entry. NLS, nuclear localization signal; PEST, PEST domain. caught at the Wolfskill Orchard, Winters, California in sumsimulans is close to the average value for genes located mer of 1995. A D. yakuba allele was isolated from an isofemale in regions of normal recombination in this species line obtained from the Drosophila Species Center at Bowling (Moriyama and Powell 1996). Silent heterozygosity Green State University. The Relish region was amplified in two in D. simulans is about five times greater than silent fragments. The first fragment was amplified using PCR primers cccggcggcaattcaccacac (forward560) and cccggcggcaattcaccaheterozygosity in D. melanogaster (Table 1). The “avercac (reverse1560); the second fragment was amplified using age” gene is z2.5 times more variable at silent sites PCR primers gtgtgggaggcatacgcaaagttccg (forward1543) and in D. simulans than in D. melanogaster (Moriyama and gttgggttaaccagtagggcgtaagc (reverse3246). Numbering of primPowell 1996). Given that Relish is not particularly polyers refers to the most 39 nucleotide of the primer using the morphic in D. simulans compared to other genes, there coordinates of GenBank entry U62005. PCR products from Relish were directly sequenced using an ABI 377 automated is some evidence that D. melanogaster Relish is less polysequencer. We analyzed 803 codons of Relish from all three morphic than one would expect. Silent divergence bespecies (the entire protein is 971 amino acids long in D. melanotween species is unremarkable, well within the range of gaster). The region surveyed corresponds to bases 561–2999 values previously documented in this species pair (e.g., of GenBank entry U62005. A 303-bp intron is located between bases 1271 and 1272 of the GenBank entry (which was derived from a cDNA). Sequences reported here can be found under GenBank accession nos. AF204277–AF204290. All sequences were easily aligned, with the exception of alignment of the D. yakuba intron with the intron of both D. simulans and D. melanogaster ; none of the analyses presented here depend on proper alignment of this region. Analyses were carried out using the SITES (Hey and Wakeley 1997), DnaSP (Rozas and Rozas 1999), PAML (Yang 1999), and Molecular Evolutionary Analysis (E. Moriyama, unpublished results) programs. Codons harboring ambiguous bases were excluded from all analyses. Variable sites in exons were classified as replacement (nonsynonymous) or silent (synonymous). For some analyses, fixed differences in exons between the D. simulans and D. melanogaster samples were assigned to one lineage or the other under the parsimony criterion. D. yakuba was used as the outgroup in such analyses; only fixed differences at sites for which the D. yakuba sequence was identical to either D. melanogaster or D. simulans were used in these analyses (e.g., sites at which each of the three species had a different base were excluded). Silent mutations were classified as preferred or unpreferred (Sharp and Lloyd 1993) through use of the outgroup method as described by Akashi (1996). We classified silent mutations that were from preferred to preferred codons or from unpreferred to unpreferred codons as “no change” mutations. Analyses of evolution in the three species lineages were also carried out by inferring the ancestral Relish sequence for the D. simulans/D. melanogaster pair using the baseml program of the Figure 2.—S, R, and I refer to silent, replacement, and PAML package. This hypothetical sequence was then comintron polymorphisms, respectively. Site 2067 in D. simulans pared to extant sequences from each of the three species. and sites 2698 and 2699 in D. melanogaster (these two sites are the first and second positions of a single codon) were not included in the analyses because of ambiguous bases. Dots RESULTS represent identity to the Sim1 allele and Zim1 allele in D. simulans and D. melanogaster, respectively. Coordinates are Figure 2 and Tables 1–5 show summaries of variation those of our GenBank entries. See Figure 1 legend for assignat the Relish gene within and between D. simulans and ment of polymorphisms to different domains of the protein according to coordinates. D. melanogaster. Silent site heterozygosity at Relish in D. 1233 Adaptive Evolution of Drosophila Immunity